20111108_moe-3_10_L1

headersmall

EPIC home | Show all experiments for moe-3 | Back to previous page

Details for experimental series: 20111108_moe-3_10_L1; gene: moe-3

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20111108_moe-3_10_L1
Date	11/8/11
Person	pete
Strain	RW11492
Treatments	None
Gene Assayed	moe-3
Type of Construct	Promoter Fusion
Imaged Timepoints	279
Edited Timepoints	136
Edited Cells	358
comments	n/a
Edited By	pete

return to top of series: 20111108_moe-3_10_L1

Strain details:

Strain Name	RW11492
Date Created	28 03 2011 12:00:00
Source of Genotype	moe-3::H1-Wcherry
Reporter Allele	stIs11491
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::moe-3
Created By	DKV/RJT/PW

return to top of series: 20111108_moe-3_10_L1

Construct details:

Plasmid Name	pJIM20::moe-3
Gene	moe-3
Transcript	F32A11.6
Promoter Length	5095
Left Primer	gcgtccgttgtcattagattttacatgt
Right Primer	ccctttcaccttgctcatcgtgc
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20111108_moe-3_10_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20111108_moe-3_10_L1

return to top of series: 20111108_moe-3_10_L1

Download annotations for this experiment

return to top of series: 20111108_moe-3_10_L1