|
EPIC home
|
Show all experiments for moe-3
|
Back to previous page
|
Details for experimental series: 20111108_moe-3_10_L1; gene: moe-3 |
experiment details |
strain details |
construct details |
full-size tree |
full-size movie |
download annotations for this experiment |
Experiment details:
Series |
20111108_moe-3_10_L1 |
Date |
11/8/11 |
Person |
pete |
Strain |
RW11492 |
Treatments |
None |
Gene Assayed |
moe-3 |
Type of Construct |
Promoter Fusion |
Imaged Timepoints |
279 |
Edited Timepoints |
136 |
Edited Cells |
358 |
comments
|
n/a |
Edited By |
pete |
return to top of series: 20111108_moe-3_10_L1
|
Strain details:
Strain Name |
RW11492 |
Date Created |
28 03 2011 12:00:00 |
Source of Genotype |
moe-3::H1-Wcherry |
Reporter Allele |
stIs11491 |
Lineage Allele |
stIs10024;zuIs178 |
Reporter Construct |
pJIM20::moe-3 |
Created By |
DKV/RJT/PW |
return to top of series: 20111108_moe-3_10_L1
|
Construct details:
Plasmid Name |
pJIM20::moe-3 |
Gene |
moe-3 |
Transcript |
F32A11.6 |
Promoter Length |
5095 |
Left Primer |
gcgtccgttgtcattagattttacatgt |
Right Primer |
ccctttcaccttgctcatcgtgc |
Vector |
pJIM20 |
Integrated, Expressing Strains |
EXPRESSINGSTRAINS |
return to top of series: 20111108_moe-3_10_L1
|
Full size movie:
return to top of series: 20111108_moe-3_10_L1
|
Fullsize tree:
return to top of series: 20111108_moe-3_10_L1
|
View images
|
Download annotations for this experiment
return to top of series: 20111108_moe-3_10_L1
|