20101209_F47H41_2_L2

headersmall

EPIC home | Show all experiments for lsy-27 | Back to previous page

Details for experimental series: 20101209_F47H41_2_L2; gene: lsy-27

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20101209_F47H41_2_L2
Date	12/9/10
Person	pete
Strain	RW10610
Treatments	None
Gene Assayed	lsy-27
Type of Construct	Promoter Fusion
Imaged Timepoints	229
Edited Timepoints	143
Edited Cells	356
comments	ubiq except P3
Edited By	pete

return to top of series: 20101209_F47H41_2_L2

Strain details:

Strain Name	RW10610
Date Created	10 09 2008 12:00:00
Source of Genotype	F47H4.1::H1-Wcherry
Reporter Allele	stIs10628
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::F47H4.1
Created By	EAP/DKV/JIM

return to top of series: 20101209_F47H41_2_L2

Construct details:

Plasmid Name	pJIM20::F47H4.1
Gene	F47H4.1
Transcript	F47H4.1
Promoter Length	2511
Left Primer	gaaatttaacttcgttttgcaggcaatt
Right Primer	actgtgaatagacgtcatgtttagatgagagt
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20101209_F47H41_2_L2

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20101209_F47H41_2_L2

return to top of series: 20101209_F47H41_2_L2

Download annotations for this experiment

return to top of series: 20101209_F47H41_2_L2