20100212_T22C83_5_L2

headersmall

EPIC home | Show all experiments for T22C8.3 | Back to previous page

Details for experimental series: 20100212_T22C83_5_L2; gene: T22C8.3

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20100212_T22C83_5_L2
Date	2/12/10
Person	pete
Strain	RW11197
Treatments	None
Gene Assayed	T22C8.3
Type of Construct	Promoter Fusion
Imaged Timepoints	187
Edited Timepoints	140
Edited Cells	361
comments	n/a
Edited By	pete

return to top of series: 20100212_T22C83_5_L2

Strain details:

Strain Name	RW11197
Date Created	29 01 2010 12:00:00
Source of Genotype	T22C8.3::H1-Wcherry
Reporter Allele	stIs10527
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::T22C8.3
Created By	EAP/DKV/JIM

return to top of series: 20100212_T22C83_5_L2

Construct details:

Plasmid Name	pJIM20::T22C8.3
Gene	T22C8.3
Transcript	T22C8.3
Promoter Length	2059
Left Primer	tattttgcttcctctatgacagttgcgt
Right Primer	ttgttcggtggttgccatgact
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20100212_T22C83_5_L2

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20100212_T22C83_5_L2

return to top of series: 20100212_T22C83_5_L2

Download annotations for this experiment

return to top of series: 20100212_T22C83_5_L2