 |
EPIC home
|
Show all experiments for nob-1
|
Back to previous page
|
Details for experimental series: 20090605_nob-1_b26_L1; gene: nob-1 |
experiment details |
strain details |
construct details |
full-size tree |
full-size movie |
download annotations for this experiment |
Experiment details:
Series |
20090605_nob-1_b26_L1 |
Date |
6/5/09 |
Person |
JIM |
Strain |
RW10896 |
Treatments |
None |
Gene Assayed |
nob-1 |
Type of Construct |
Promoter Fusion |
Imaged Timepoints |
229 |
Edited Timepoints |
155 |
Edited Cells |
376 |
comments
|
posterior cells |
Edited By |
JIM |
return to top of series: 20090605_nob-1_b26_L1
|
Strain details:
Strain Name |
RW10896 |
Date Created |
17 04 2009 12:00:00 |
Source of Genotype |
nob-1::H1-Wcherry |
Reporter Allele |
stIs10808 |
Lineage Allele |
stIs10024;zuIs178 |
Reporter Construct |
pJIM20::nob-1 |
Created By |
EAP/DKV |
return to top of series: 20090605_nob-1_b26_L1
|
Construct details:
Plasmid Name |
pJIM20::nob-1 |
Gene |
nob-1 |
Transcript |
Y75B8A.2a |
Promoter Length |
5418 |
Left Primer |
atacacatagatccctcgaaccaaatcc |
Right Primer |
ttgcatcaccgaaatcattccatatatgagc |
Vector |
pJIM20 |
Integrated, Expressing Strains |
EXPRESSINGSTRAINS |
return to top of series: 20090605_nob-1_b26_L1
|
Full size movie:
return to top of series: 20090605_nob-1_b26_L1
|
Fullsize tree:
return to top of series: 20090605_nob-1_b26_L1
|
View images
|
Download annotations for this experiment
return to top of series: 20090605_nob-1_b26_L1
|