20090605_nob-1_b26_L1

headersmall

EPIC home | Show all experiments for nob-1 | Back to previous page

Details for experimental series: 20090605_nob-1_b26_L1; gene: nob-1

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20090605_nob-1_b26_L1
Date	6/5/09
Person	JIM
Strain	RW10896
Treatments	None
Gene Assayed	nob-1
Type of Construct	Promoter Fusion
Imaged Timepoints	229
Edited Timepoints	155
Edited Cells	376
comments	posterior cells
Edited By	JIM

return to top of series: 20090605_nob-1_b26_L1

Strain details:

Strain Name	RW10896
Date Created	17 04 2009 12:00:00
Source of Genotype	nob-1::H1-Wcherry
Reporter Allele	stIs10808
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::nob-1
Created By	EAP/DKV

return to top of series: 20090605_nob-1_b26_L1

Construct details:

Plasmid Name	pJIM20::nob-1
Gene	nob-1
Transcript	Y75B8A.2a
Promoter Length	5418
Left Primer	atacacatagatccctcgaaccaaatcc
Right Primer	ttgcatcaccgaaatcattccatatatgagc
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20090605_nob-1_b26_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20090605_nob-1_b26_L1

return to top of series: 20090605_nob-1_b26_L1

Download annotations for this experiment

return to top of series: 20090605_nob-1_b26_L1