20090531_irx-1_b1_L1

headersmall

EPIC home | Show all experiments for irx-1 | Back to previous page

Details for experimental series: 20090531_irx-1_b1_L1; gene: irx-1

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20090531_irx-1_b1_L1
Date	5/31/09
Person	JIM
Strain	RW10894
Treatments	None
Gene Assayed	irx-1
Type of Construct	Promoter Fusion
Imaged Timepoints	254
Edited Timepoints	150
Edited Cells	360
comments	n/a
Edited By	JIM

return to top of series: 20090531_irx-1_b1_L1

Strain details:

Strain Name	RW10894
Date Created	17 04 2009 12:00:00
Source of Genotype	irx-1::H1-Wcherry
Reporter Allele	stIs10719
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::irx-1
Created By	EAP/DKV

return to top of series: 20090531_irx-1_b1_L1

Construct details:

Plasmid Name	pJIM20::irx-1
Gene	irx-1
Transcript	C36F7.1
Promoter Length	5272
Left Primer	gactactgtagcgtttgcgtcgatttac
Right Primer	attggcaataggaatcattgtgatggtgt
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20090531_irx-1_b1_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20090531_irx-1_b1_L1

return to top of series: 20090531_irx-1_b1_L1

Download annotations for this experiment

return to top of series: 20090531_irx-1_b1_L1