20090428_F21D5_9_9_L2

headersmall

EPIC home | Show all experiments for F21D5.9 | Back to previous page

Details for experimental series: 20090428_F21D5_9_9_L2; gene: F21D5.9

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20090428_F21D5_9_9_L2
Date	4/28/09
Person	JIM
Strain	RW10846
Treatments	None
Gene Assayed	F21D5.9
Type of Construct	Promoter Fusion
Imaged Timepoints	261
Edited Timepoints	160
Edited Cells	387
comments	AB neuronal;MSpp subsets
Edited By	JIM

return to top of series: 20090428_F21D5_9_9_L2

Strain details:

Strain Name	RW10846
Date Created	23 02 2009 12:00:00
Source of Genotype	F21D5.9::H1-Wcherry
Reporter Allele	stIs10636
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::F21D5.9
Created By	EAP/DKV/JIM

return to top of series: 20090428_F21D5_9_9_L2

Construct details:

Plasmid Name	pJIM20::F21D5.9
Gene	F21D5.9
Transcript	F21D5.9
Promoter Length	3686
Left Primer	aagagctaagtgtgatcggtatgggatt
Right Primer	cattggaccatctgccattcttagttgaaaaaatgacgttg
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20090428_F21D5_9_9_L2

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20090428_F21D5_9_9_L2

return to top of series: 20090428_F21D5_9_9_L2

Download annotations for this experiment

return to top of series: 20090428_F21D5_9_9_L2