 |
|
EPIC home
|
Show all experiments for F21D5.9
|
Back to previous page
|
| Details for experimental series: 20090310_F21D5_9_1_L1; gene: F21D5.9 |
| experiment details |
strain details |
construct details |
full-size tree |
full-size movie |
download annotations for this experiment |
Experiment details:
Series |
20090310_F21D5_9_1_L1 |
Date |
3/10/09 |
Person |
JIM |
Strain |
RW10845 |
Treatments |
None |
Gene Assayed |
F21D5.9 |
Type of Construct |
Promoter Fusion |
Imaged Timepoints |
269 |
Edited Timepoints |
170 |
Edited Cells |
414 |
comments
|
anterior biased in ABpxp, subset of ABa, MS. It took 8 hours to edit from 350 to 486 cells. P4 lineage not editable beyond 350 cells **JIM - not really edited to 486 - many nucs and errors after 170 |
Edited By |
JIM/ZZ |
return to top of series: 20090310_F21D5_9_1_L1
|
Strain details:
Strain Name |
RW10845 |
Date Created |
23 02 2009 12:00:00 |
Source of Genotype |
F21D5.9::H1-Wcherry |
Reporter Allele |
stIs10845 |
Lineage Allele |
stIs10024;zuIs178 |
Reporter Construct |
pJIM20::F21D5.9 |
Created By |
EAP/DKV/JIM |
return to top of series: 20090310_F21D5_9_1_L1
|
Construct details:
Plasmid Name |
pJIM20::F21D5.9 |
Gene |
F21D5.9 |
Transcript |
F21D5.9 |
Promoter Length |
3686 |
Left Primer |
aagagctaagtgtgatcggtatgggatt |
Right Primer |
cattggaccatctgccattcttagttgaaaaaatgacgttg |
Vector |
pJIM20 |
Integrated, Expressing Strains |
EXPRESSINGSTRAINS |
return to top of series: 20090310_F21D5_9_1_L1
|
Full size movie:
return to top of series: 20090310_F21D5_9_1_L1
|
Fullsize tree:
return to top of series: 20090310_F21D5_9_1_L1
|
View images
|
Download annotations for this experiment
return to top of series: 20090310_F21D5_9_1_L1
|
