20090225_nob-1_L2

headersmall

EPIC home | Show all experiments for nob-1 | Back to previous page

Details for experimental series: 20090225_nob-1_L2; gene: nob-1

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20090225_nob-1_L2
Date	2/25/09
Person	JIM
Strain	RW10865
Treatments	None
Gene Assayed	nob-1
Type of Construct	Promoter Fusion
Imaged Timepoints	250
Edited Timepoints	155
Edited Cells	360
comments	dim green at bottom - some cell positions may be questionable, ABarpp
Edited By	JIM

return to top of series: 20090225_nob-1_L2

Strain details:

Strain Name	RW10865
Date Created	23 02 2009 12:00:00
Source of Genotype	nob-1::H1-Wcherry
Reporter Allele	stIs10653
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::nob-1
Created By	EAP/DKV/JIM

return to top of series: 20090225_nob-1_L2

Construct details:

Plasmid Name	pJIM20::nob-1
Gene	nob-1
Transcript	Y75B8A.2a
Promoter Length	5418
Left Primer	atacacatagatccctcgaaccaaatcc
Right Primer	ttgcatcaccgaaatcattccatatatgagc
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20090225_nob-1_L2

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20090225_nob-1_L2

return to top of series: 20090225_nob-1_L2

Download annotations for this experiment

return to top of series: 20090225_nob-1_L2