20081111_B0310_2_8_L1

headersmall

EPIC home | Show all experiments for B0310.2 | Back to previous page

Details for experimental series: 20081111_B0310_2_8_L1; gene: B0310.2

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20081111_B0310_2_8_L1
Date	11/11/08
Person	JIM
Strain	RW10803
Treatments	None
Gene Assayed	B0310.2
Type of Construct	Promoter Fusion
Imaged Timepoints	259
Edited Timepoints	150
Edited Cells	359
comments	E and c-neuron biased
Edited By	JIM

return to top of series: 20081111_B0310_2_8_L1

Strain details:

Strain Name	RW10803
Date Created	30 12 2008 12:00:00
Source of Genotype	B0310.2::H1-Wcherry
Reporter Allele	stIs10695
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::B0310.2
Created By	EAP/DKV/JIM

return to top of series: 20081111_B0310_2_8_L1

Construct details:

Plasmid Name	pJIM20::B0310.2
Gene	B0310.2
Transcript	B0310.2
Promoter Length	3837
Left Primer	tgagtggtagtgagtaggtttgcgattt
Right Primer	gggttgtgacttttccatcgttgttga
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20081111_B0310_2_8_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20081111_B0310_2_8_L1

return to top of series: 20081111_B0310_2_8_L1

Download annotations for this experiment

return to top of series: 20081111_B0310_2_8_L1