20081106_nhr-57_5_L1

headersmall

EPIC home | Show all experiments for nhr-57 | Back to previous page

Details for experimental series: 20081106_nhr-57_5_L1; gene: nhr-57

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20081106_nhr-57_5_L1
Date	11/6/08
Person	JIM
Strain	RW10770
Treatments	None
Gene Assayed	nhr-57
Type of Construct	Promoter Fusion
Imaged Timepoints	246
Edited Timepoints	150
Edited Cells	361
comments	gut/hyp
Edited By	EAP

return to top of series: 20081106_nhr-57_5_L1

Strain details:

Strain Name	RW10770
Date Created	14 11 2008 12:00:00
Source of Genotype	nhr-57::H1-Wcherry
Reporter Allele	stIs10517
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::nhr-57
Created By	EAP/DKV/JIM

return to top of series: 20081106_nhr-57_5_L1

Construct details:

Plasmid Name	pJIM20::nhr-57
Gene	nhr-57
Transcript	T05B4.2
Promoter Length	2051
Left Primer	caattcatccagcaatgtatttcctcat
Right Primer	ttcgcgagccaccaacatctcttgattcact
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20081106_nhr-57_5_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20081106_nhr-57_5_L1

return to top of series: 20081106_nhr-57_5_L1

Download annotations for this experiment

return to top of series: 20081106_nhr-57_5_L1