20081105_T22C8_3_1_L2

headersmall

EPIC home | Show all experiments for T22C8.3 | Back to previous page

Details for experimental series: 20081105_T22C8_3_1_L2; gene: T22C8.3

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20081105_T22C8_3_1_L2
Date	11/5/08
Person	JIM
Strain	RW10772
Treatments	None
Gene Assayed	T22C8.3
Type of Construct	Promoter Fusion
Imaged Timepoints	237
Edited Timepoints	135
Edited Cells	368
comments	ubiq except posterior gut and D
Edited By	JIM

return to top of series: 20081105_T22C8_3_1_L2

Strain details:

Strain Name	RW10772
Date Created	14 11 2008 12:00:00
Source of Genotype	T22C8.3::H1-Wcherry
Reporter Allele	stIs10526
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::T22C8.3
Created By	EAP/DKV/JIM

return to top of series: 20081105_T22C8_3_1_L2

Construct details:

Plasmid Name	pJIM20::T22C8.3
Gene	T22C8.3
Transcript	T22C8.3
Promoter Length	2059
Left Primer	tattttgcttcctctatgacagttgcgt
Right Primer	ttgttcggtggttgccatgact
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20081105_T22C8_3_1_L2

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20081105_T22C8_3_1_L2

return to top of series: 20081105_T22C8_3_1_L2

Download annotations for this experiment

return to top of series: 20081105_T22C8_3_1_L2