![headersmall](../bckgrnds/EPIC_sm2.gif) |
EPIC home
|
Show all experiments for T22C8.3
|
Back to previous page
|
Details for experimental series: 20081105_T22C8_3_1_L2; gene: T22C8.3 |
experiment details |
strain details |
construct details |
full-size tree |
full-size movie |
download annotations for this experiment |
Experiment details:
Series |
20081105_T22C8_3_1_L2 |
Date |
11/5/08 |
Person |
JIM |
Strain |
RW10772 |
Treatments |
None |
Gene Assayed |
T22C8.3 |
Type of Construct |
Promoter Fusion |
Imaged Timepoints |
237 |
Edited Timepoints |
135 |
Edited Cells |
368 |
comments
|
ubiq except posterior gut and D |
Edited By |
JIM |
return to top of series: 20081105_T22C8_3_1_L2
|
Strain details:
Strain Name |
RW10772 |
Date Created |
14 11 2008 12:00:00 |
Source of Genotype |
T22C8.3::H1-Wcherry |
Reporter Allele |
stIs10526 |
Lineage Allele |
stIs10024;zuIs178 |
Reporter Construct |
pJIM20::T22C8.3 |
Created By |
EAP/DKV/JIM |
return to top of series: 20081105_T22C8_3_1_L2
|
Construct details:
Plasmid Name |
pJIM20::T22C8.3 |
Gene |
T22C8.3 |
Transcript |
T22C8.3 |
Promoter Length |
2059 |
Left Primer |
tattttgcttcctctatgacagttgcgt |
Right Primer |
ttgttcggtggttgccatgact |
Vector |
pJIM20 |
Integrated, Expressing Strains |
EXPRESSINGSTRAINS |
return to top of series: 20081105_T22C8_3_1_L2
|
Full size movie:
return to top of series: 20081105_T22C8_3_1_L2
|
Fullsize tree:
return to top of series: 20081105_T22C8_3_1_L2
|
View images
|
Download annotations for this experiment
return to top of series: 20081105_T22C8_3_1_L2
|