20081104_nhr-171_17_L2

headersmall

EPIC home | Show all experiments for nhr-171 | Back to previous page

Details for experimental series: 20081104_nhr-171_17_L2; gene: nhr-171

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20081104_nhr-171_17_L2
Date	11/4/08
Person	JIM
Strain	RW10766
Treatments	None
Gene Assayed	nhr-171
Type of Construct	Promoter Fusion
Imaged Timepoints	268
Edited Timepoints	119
Edited Cells	361
comments	hyp/AB neurons?
Edited By	pete

return to top of series: 20081104_nhr-171_17_L2

Strain details:

Strain Name	RW10766
Date Created	14 11 2008 12:00:00
Source of Genotype	nhr-171::H1-Wcherry
Reporter Allele	stIs10529
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::nhr-171
Created By	EAP/DKV/JIM

return to top of series: 20081104_nhr-171_17_L2

Construct details:

Plasmid Name	pJIM20::nhr-171
Gene	nhr-171
Transcript	C54F6.8
Promoter Length	2277
Left Primer	ggggtttcaaagaaaaacggagtaaaat
Right Primer	tgtagctggtgtttgcatataatgataaatattgtcctaaa
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20081104_nhr-171_17_L2

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20081104_nhr-171_17_L2

return to top of series: 20081104_nhr-171_17_L2

Download annotations for this experiment

return to top of series: 20081104_nhr-171_17_L2