20081031_pes-1_7_L2

headersmall

EPIC home | Show all experiments for pes-1 | Back to previous page

Details for experimental series: 20081031_pes-1_7_L2; gene: pes-1

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20081031_pes-1_7_L2
Date	10/31/08
Person	JIM
Strain	RW10765
Treatments	None
Gene Assayed	pes-1
Type of Construct	Promoter Fusion
Imaged Timepoints	250
Edited Timepoints	145
Edited Cells	362
comments	asymmetric patterns in most lineages
Edited By	JIM

return to top of series: 20081031_pes-1_7_L2

Strain details:

Strain Name	RW10765
Date Created	14 11 2008 12:00:00
Source of Genotype	pes-1::H1-Wcherry
Reporter Allele	stIs10622
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::pes-1
Created By	EAP/DKV/JIM

return to top of series: 20081031_pes-1_7_L2

Construct details:

Plasmid Name	pJIM20::pes-1
Gene	pes-1
Transcript	T28H11.4
Promoter Length	2937
Left Primer	tgattttattacggctttcgccaaatat
Right Primer	tttgattgatgacgtcatctaaatgtattattatgtagtag
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20081031_pes-1_7_L2

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20081031_pes-1_7_L2

return to top of series: 20081031_pes-1_7_L2

Download annotations for this experiment

return to top of series: 20081031_pes-1_7_L2