20081030_ref-2a_14_L2

headersmall

EPIC home | Show all experiments for ref-2 | Back to previous page

Details for experimental series: 20081030_ref-2a_14_L2; gene: ref-2

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20081030_ref-2a_14_L2
Date	10/30/08
Person	JIM
Strain	RW10764
Treatments	None
Gene Assayed	ref-2
Type of Construct	Promoter Fusion
Imaged Timepoints	269
Edited Timepoints	130
Edited Cells	384
comments	anterior MS ggdaughters, ABalaxa, ABara, ABarpaaa
Edited By	JIM

return to top of series: 20081030_ref-2a_14_L2

Strain details:

Strain Name	RW10764
Date Created	14 11 2008 12:00:00
Source of Genotype	ref-2a::H1-Wcherry
Reporter Allele	stIs10631
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::ref-2a
Created By	EAP/DKV/JIM

return to top of series: 20081030_ref-2a_14_L2

Construct details:

Plasmid Name	pJIM20::ref-2a
Gene	ref-2a
Transcript	C47C12.3a
Promoter Length	4079
Left Primer	tatgtgttctcgacaatcaagtgagcat
Right Primer	ataatagtcactatgcatcattttgtctgaaaataaggttc
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20081030_ref-2a_14_L2

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20081030_ref-2a_14_L2

return to top of series: 20081030_ref-2a_14_L2

Download annotations for this experiment

return to top of series: 20081030_ref-2a_14_L2