20081030_F21A10_2a_10_L1

headersmall

EPIC home | Show all experiments for F21A10.2 | Back to previous page

Details for experimental series: 20081030_F21A10_2a_10_L1; gene: F21A10.2

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20081030_F21A10_2a_10_L1
Date	10/30/08
Person	JIM
Strain	RW10763
Treatments	None
Gene Assayed	F21A10.2
Type of Construct	Promoter Fusion
Imaged Timepoints	244
Edited Timepoints	170
Edited Cells	367
comments	biased ubiq
Edited By	JIM

return to top of series: 20081030_F21A10_2a_10_L1

Strain details:

Strain Name	RW10763
Date Created	14 11 2008 12:00:00
Source of Genotype	F21A10.2a::H1-Wcherry
Reporter Allele	stIs10655
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::F21A10.2a
Created By	EAP/DKV/JIM

return to top of series: 20081030_F21A10_2a_10_L1

Construct details:

Plasmid Name	pJIM20::F21A10.2a
Gene	F21A10.2a
Transcript	F21A10.2a
Promoter Length	5285
Left Primer	ctattttgagactgtgcgaaatttcgag
Right Primer	tcgaatattttgatccatatttccttgttcaaatgct
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20081030_F21A10_2a_10_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20081030_F21A10_2a_10_L1

return to top of series: 20081030_F21A10_2a_10_L1

Download annotations for this experiment

return to top of series: 20081030_F21A10_2a_10_L1