20081029_sdc-2_3_L1

headersmall

EPIC home | Show all experiments for sdc-2 | Back to previous page

Details for experimental series: 20081029_sdc-2_3_L1; gene: sdc-2

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20081029_sdc-2_3_L1
Date	10/29/08
Person	JIM
Strain	RW10759
Treatments	None
Gene Assayed	sdc-2
Type of Construct	Promoter Fusion
Imaged Timepoints	274
Edited Timepoints	130
Edited Cells	361
comments	ubiq
Edited By	JIM

return to top of series: 20081029_sdc-2_3_L1

Strain details:

Strain Name	RW10759
Date Created	14 11 2008 12:00:00
Source of Genotype	sdc-2::H1-Wcherry
Reporter Allele	stIs10648
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::sdc-2
Created By	EAP/DKV/JIM

return to top of series: 20081029_sdc-2_3_L1

Construct details:

Plasmid Name	pJIM20::sdc-2
Gene	sdc-2
Transcript	C35C5.1
Promoter Length	3783
Left Primer	actggcattcctagtctccatcattttt
Right Primer	ttctgattcatcactcataagtaccggaagagaaaatcacg
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20081029_sdc-2_3_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20081029_sdc-2_3_L1

return to top of series: 20081029_sdc-2_3_L1

Download annotations for this experiment

return to top of series: 20081029_sdc-2_3_L1