 |
|
EPIC home
|
Show all experiments for nhr-69
|
Back to previous page
|
| Details for experimental series: 20081028_T23H4_2_10_L1; gene: nhr-69 |
| experiment details |
strain details |
construct details |
full-size tree |
full-size movie |
download annotations for this experiment |
Experiment details:
Series |
20081028_T23H4_2_10_L1 |
Date |
10/28/08 |
Person |
JIM |
Strain |
RW11052 |
Treatments |
None |
Gene Assayed |
nhr-69 |
Type of Construct |
Promoter Fusion |
Imaged Timepoints |
274 |
Edited Timepoints |
160 |
Edited Cells |
351 |
comments
|
E, Chyp, D, ABhyp |
Edited By |
JIM |
return to top of series: 20081028_T23H4_2_10_L1
|
Strain details:
Strain Name |
RW11052 |
Date Created |
n/a |
Source of Genotype |
T23H4.2::H1-Wcherry |
Reporter Allele |
stIs10658 |
Lineage Allele |
stIs10024;zuIs178 |
Reporter Construct |
pJIM20::T23H4.2 |
Created By |
EAP/JIM/DKV |
return to top of series: 20081028_T23H4_2_10_L1
|
Construct details:
Plasmid Name |
pJIM20::T23H4.2 |
Gene |
T23H4.2 |
Transcript |
T23H4.2 |
Promoter Length |
4644 |
Left Primer |
aaccagaaaaaaagaatttcccacattg |
Right Primer |
acatatttcttcgaccatactttttgtctaaatatttatg |
Vector |
pJIM20 |
Integrated, Expressing Strains |
EXPRESSINGSTRAINS |
return to top of series: 20081028_T23H4_2_10_L1
|
Full size movie:
return to top of series: 20081028_T23H4_2_10_L1
|
Fullsize tree:
return to top of series: 20081028_T23H4_2_10_L1
|
View images
|
Download annotations for this experiment
return to top of series: 20081028_T23H4_2_10_L1
|