 |
EPIC home
|
Show all experiments for mnm-2
|
Back to previous page
|
Details for experimental series: 20081024_mnm-2_7_L2; gene: mnm-2 |
experiment details |
strain details |
construct details |
full-size tree |
full-size movie |
download annotations for this experiment |
Experiment details:
Series |
20081024_mnm-2_7_L2 |
Date |
10/24/08 |
Person |
JIM |
Strain |
RW10722 |
Treatments |
None |
Gene Assayed |
mnm-2 |
Type of Construct |
Promoter Fusion |
Imaged Timepoints |
269 |
Edited Timepoints |
121 |
Edited Cells |
361 |
comments
|
stripy pattern in AB hyp lineages |
Edited By |
pete |
return to top of series: 20081024_mnm-2_7_L2
|
Strain details:
Strain Name |
RW10722 |
Date Created |
27 10 2008 12:00:00 |
Source of Genotype |
mnm-2::H1-Wcherry |
Reporter Allele |
stIs10620 |
Lineage Allele |
stIs10024;zuIs178 |
Reporter Construct |
pJIM20::mnm-2 |
Created By |
EAP/DKV/JIM |
return to top of series: 20081024_mnm-2_7_L2
|
Construct details:
Plasmid Name |
pJIM20::mnm-2 |
Gene |
mnm-2 |
Transcript |
C10A4.8 |
Promoter Length |
5398 |
Left Primer |
caactgagaaaggttagaaatgtgaccg |
Right Primer |
actagcttcgactgacatggctagt |
Vector |
pJIM20 |
Integrated, Expressing Strains |
EXPRESSINGSTRAINS |
return to top of series: 20081024_mnm-2_7_L2
|
Full size movie:
return to top of series: 20081024_mnm-2_7_L2
|
Fullsize tree:
return to top of series: 20081024_mnm-2_7_L2
|
View images
|
Download annotations for this experiment
return to top of series: 20081024_mnm-2_7_L2
|