20081023_ceh-21_5_L1

headersmall

EPIC home | Show all experiments for ceh-21 | Back to previous page

Details for experimental series: 20081023_ceh-21_5_L1; gene: ceh-21

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20081023_ceh-21_5_L1
Date	10/23/08
Person	JIM
Strain	RW10724
Treatments	None
Gene Assayed	ceh-21
Type of Construct	Promoter Fusion
Imaged Timepoints	269
Edited Timepoints	190
Edited Cells	355
comments	ubiq biased to muscle and neuron
Edited By	EAP

return to top of series: 20081023_ceh-21_5_L1

Strain details:

Strain Name	RW10724
Date Created	27 10 2008 12:00:00
Source of Genotype	ceh-21::H1-Wcherry
Reporter Allele	stIs10567
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::ceh-21
Created By	EAP/DKV/JIM

return to top of series: 20081023_ceh-21_5_L1

Construct details:

Plasmid Name	pJIM20::ceh-21
Gene	ceh-21
Transcript	T26C11.6
Promoter Length	2146
Left Primer	aaacaacgcctaggttagtttttttccc
Right Primer	ttgaaattgctgagacatctaaaaaatattatggtaaaaa
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20081023_ceh-21_5_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20081023_ceh-21_5_L1

return to top of series: 20081023_ceh-21_5_L1

Download annotations for this experiment

return to top of series: 20081023_ceh-21_5_L1