20081022_pax-3_1_L1

headersmall

EPIC home | Show all experiments for pax-3 | Back to previous page

Details for experimental series: 20081022_pax-3_1_L1; gene: pax-3

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20081022_pax-3_1_L1
Date	10/22/08
Person	JIM
Strain	RW10744
Treatments	None
Gene Assayed	pax-3
Type of Construct	Promoter Fusion
Imaged Timepoints	259
Edited Timepoints	150
Edited Cells	364
comments	ABpxapp, ABpxaapp
Edited By	JIM

return to top of series: 20081022_pax-3_1_L1

Strain details:

Strain Name	RW10744
Date Created	27 10 2008 12:00:00
Source of Genotype	pax-3::H1-Wcherry
Reporter Allele	stIs10644
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::pax-3
Created By	EAP/DKV/JIM

return to top of series: 20081022_pax-3_1_L1

Construct details:

Plasmid Name	pJIM20::pax-3
Gene	pax-3
Transcript	F27E5.2
Promoter Length	2616
Left Primer	ttgtcggaagtggttgtactctctcttc
Right Primer	gatagaatctgtggtcattttgttagtagtggatgggatat
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20081022_pax-3_1_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20081022_pax-3_1_L1

return to top of series: 20081022_pax-3_1_L1

Download annotations for this experiment

return to top of series: 20081022_pax-3_1_L1