20081016_F28C6_1_10_L2

headersmall

EPIC home | Show all experiments for F28C6.1 | Back to previous page

Details for experimental series: 20081016_F28C6_1_10_L2; gene: F28C6.1

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20081016_F28C6_1_10_L2
Date	10/16/08
Person	JIM
Strain	RW10751
Treatments	None
Gene Assayed	F28C6.1
Type of Construct	Promoter Fusion
Imaged Timepoints	264
Edited Timepoints	140
Edited Cells	364
comments	biased ubiq
Edited By	JIM

return to top of series: 20081016_F28C6_1_10_L2

Strain details:

Strain Name	RW10751
Date Created	27 10 2008 12:00:00
Source of Genotype	F28C6.1::H1-Wcherry
Reporter Allele	stIs10697
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::F28C6.1
Created By	EAP/DKV/JIM

return to top of series: 20081016_F28C6_1_10_L2

Construct details:

Plasmid Name	pJIM20::F28C6.1
Gene	F28C6.1
Transcript	F28C6.1
Promoter Length	5502
Left Primer	tttcggaaccttcatttctaaaacagct
Right Primer	atacgggtagtacgacattattgaagatgttatgtgaaagg
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20081016_F28C6_1_10_L2

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20081016_F28C6_1_10_L2

return to top of series: 20081016_F28C6_1_10_L2

Download annotations for this experiment

return to top of series: 20081016_F28C6_1_10_L2