20081013_ceh-16_b7_L1

headersmall

EPIC home | Show all experiments for ceh-16.b | Back to previous page

Details for experimental series: 20081013_ceh-16_b7_L1; gene: ceh-16.b

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20081013_ceh-16_b7_L1
Date	10/13/08
Person	JIM
Strain	RW10753
Treatments	None
Gene Assayed	ceh-16.b
Type of Construct	Promoter Fusion
Imaged Timepoints	246
Edited Timepoints	165
Edited Cells	367
comments	Anterior stripes in ABarpp/araa, several other AB sublineages, MSxaxa
Edited By	JIM

return to top of series: 20081013_ceh-16_b7_L1

Strain details:

Strain Name	RW10753
Date Created	27 10 2008 12:00:00
Source of Genotype	ceh-16b::H1-Wcherry
Reporter Allele	stIs10661
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::ceh-16b
Created By	EAP/DKV/JIM

return to top of series: 20081013_ceh-16_b7_L1

Construct details:

Plasmid Name	pJIM20::ceh-16b
Gene	ceh-16b
Transcript	C13G5.1b
Promoter Length	4621
Left Primer	ttattaattgatgtagcggcagacgaag
Right Primer	accgaatttcagaatcatttctgaaaaaataaataaaatga
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20081013_ceh-16_b7_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20081013_ceh-16_b7_L1

return to top of series: 20081013_ceh-16_b7_L1

Download annotations for this experiment

return to top of series: 20081013_ceh-16_b7_L1