20081007_nhr-68_14_L2

headersmall

EPIC home | Show all experiments for nhr-68 | Back to previous page

Details for experimental series: 20081007_nhr-68_14_L2; gene: nhr-68

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20081007_nhr-68_14_L2
Date	10/7/08
Person	JIM
Strain	RW10732
Treatments	None
Gene Assayed	nhr-68
Type of Construct	Promoter Fusion
Imaged Timepoints	251
Edited Timepoints	142
Edited Cells	352
comments	gut and hyp
Edited By	pete

return to top of series: 20081007_nhr-68_14_L2

Strain details:

Strain Name	RW10732
Date Created	13 10 2008 12:00:00
Source of Genotype	nhr-68::H1-Wcherry
Reporter Allele	stIs10507
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::nhr-68
Created By	EAP/DKV/JIM

return to top of series: 20081007_nhr-68_14_L2

Construct details:

Plasmid Name	pJIM20::nhr-68
Gene	nhr-68
Transcript	H12C20.3
Promoter Length	2352
Left Primer	tcaaaaagcatttgaaacatattggagc
Right Primer	aacctctttgttctccattgacggaggattagaaccg
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20081007_nhr-68_14_L2

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20081007_nhr-68_14_L2

return to top of series: 20081007_nhr-68_14_L2

Download annotations for this experiment

return to top of series: 20081007_nhr-68_14_L2