20081007_F47H4_1_14_L2

headersmall

EPIC home | Show all experiments for lsy-27 | Back to previous page

Details for experimental series: 20081007_F47H4_1_14_L2; gene: lsy-27

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20081007_F47H4_1_14_L2
Date	10/7/08
Person	JIM
Strain	RW10731
Treatments	None
Gene Assayed	lsy-27
Type of Construct	Promoter Fusion
Imaged Timepoints	268
Edited Timepoints	150
Edited Cells	376
comments	ABpra, ABalp, C muiscle biases
Edited By	JIM

return to top of series: 20081007_F47H4_1_14_L2

Strain details:

Strain Name	RW10731
Date Created	13 10 2008 12:00:00
Source of Genotype	F47H4.1::H1-Wcherry
Reporter Allele	stIs10629
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::F47H4.1
Created By	EAP/DKV/JIM

return to top of series: 20081007_F47H4_1_14_L2

Construct details:

Plasmid Name	pJIM20::F47H4.1
Gene	F47H4.1
Transcript	F47H4.1
Promoter Length	2511
Left Primer	gaaatttaacttcgttttgcaggcaatt
Right Primer	actgtgaatagacgtcatgtttagatgagagt
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20081007_F47H4_1_14_L2

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20081007_F47H4_1_14_L2

return to top of series: 20081007_F47H4_1_14_L2

Download annotations for this experiment

return to top of series: 20081007_F47H4_1_14_L2