20081007_F47H4_1_14_L1

headersmall

EPIC home | Show all experiments for F47H4.1 | Back to previous page

Details for experimental series: 20081007_F47H4_1_14_L1; gene: F47H4.1

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20081007_F47H4_1_14_L1
Date	10/7/08
Person	JIM
Strain	RW10731
Treatments	None
Gene Assayed	F47H4.1
Type of Construct	Promoter Fusion
Imaged Timepoints	268
Edited Timepoints	150
Edited Cells	371
comments	different AB bias than L2?
Edited By	JIM

return to top of series: 20081007_F47H4_1_14_L1

Strain details:

Strain Name	RW10731
Date Created	13 10 2008 12:00:00
Source of Genotype	F47H4.1::H1-Wcherry
Reporter Allele	stIs10629
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::F47H4.1
Created By	EAP/DKV/JIM

return to top of series: 20081007_F47H4_1_14_L1

Construct details:

Plasmid Name	pJIM20::F47H4.1
Gene	F47H4.1
Transcript	F47H4.1
Promoter Length	2511
Left Primer	gaaatttaacttcgttttgcaggcaatt
Right Primer	actgtgaatagacgtcatgtttagatgagagt
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20081007_F47H4_1_14_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20081007_F47H4_1_14_L1

return to top of series: 20081007_F47H4_1_14_L1

Download annotations for this experiment

return to top of series: 20081007_F47H4_1_14_L1