20081006_rad-26_6_L2

headersmall

EPIC home | Show all experiments for rad-26 | Back to previous page

Details for experimental series: 20081006_rad-26_6_L2; gene: rad-26

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20081006_rad-26_6_L2
Date	10/6/08
Person	JIM
Strain	RW10733
Treatments	None
Gene Assayed	rad-26
Type of Construct	Promoter Fusion
Imaged Timepoints	254
Edited Timepoints	140
Edited Cells	367
comments	ZZ partial edit to 160
Edited By	JIM

return to top of series: 20081006_rad-26_6_L2

Strain details:

Strain Name	RW10733
Date Created	13 10 2008 12:00:00
Source of Genotype	rad-26::H1-Wcherry
Reporter Allele	stIs10570
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::rad-26
Created By	EAP/DKV/JIM

return to top of series: 20081006_rad-26_6_L2

Construct details:

Plasmid Name	pJIM20::rad-26
Gene	rad-26
Transcript	C27B7.4
Promoter Length	2427
Left Primer	gcagactgcttttctcaatcatcatctt
Right Primer	gtctatttcttcactcatacctcagtttgattaggaattat
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20081006_rad-26_6_L2

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20081006_rad-26_6_L2

return to top of series: 20081006_rad-26_6_L2

Download annotations for this experiment

return to top of series: 20081006_rad-26_6_L2