20081002_moe-3_8_L1

headersmall

EPIC home | Show all experiments for moe-3 | Back to previous page

Details for experimental series: 20081002_moe-3_8_L1; gene: moe-3

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20081002_moe-3_8_L1
Date	10/1/08
Person	JIM
Strain	RW10734
Treatments	None
Gene Assayed	moe-3
Type of Construct	Promoter Fusion
Imaged Timepoints	246
Edited Timepoints	150
Edited Cells	353
comments	Ca subset, asymmetric in AB
Edited By	JIM

return to top of series: 20081002_moe-3_8_L1

Strain details:

Strain Name	RW10734
Date Created	13 10 2008 12:00:00
Source of Genotype	moe-3::H1-Wcherry
Reporter Allele	stIs10700
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::moe-3
Created By	EAP/DKV/JIM

return to top of series: 20081002_moe-3_8_L1

Construct details:

Plasmid Name	pJIM20::moe-3
Gene	moe-3
Transcript	F32A11.6
Promoter Length	5095
Left Primer	gcgtccgttgtcattagattttacatgt
Right Primer	ccctttcaccttgctcatcgtgc
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20081002_moe-3_8_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20081002_moe-3_8_L1

return to top of series: 20081002_moe-3_8_L1

Download annotations for this experiment

return to top of series: 20081002_moe-3_8_L1