20081002_F28C6_1_2_L1

headersmall

EPIC home | Show all experiments for F28C6.1 | Back to previous page

Details for experimental series: 20081002_F28C6_1_2_L1; gene: F28C6.1

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20081002_F28C6_1_2_L1
Date	10/2/08
Person	JIM
Strain	RW10730
Treatments	None
Gene Assayed	F28C6.1
Type of Construct	Promoter Fusion
Imaged Timepoints	274
Edited Timepoints	145
Edited Cells	359
comments	ubiq
Edited By	JIM

return to top of series: 20081002_F28C6_1_2_L1

Strain details:

Strain Name	RW10730
Date Created	13 10 2008 12:00:00
Source of Genotype	F28C6.1::H1-Wcherry
Reporter Allele	stIs10696
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::F28C6.1
Created By	EAP/DKV/JIM

return to top of series: 20081002_F28C6_1_2_L1

Construct details:

Plasmid Name	pJIM20::F28C6.1
Gene	F28C6.1
Transcript	F28C6.1
Promoter Length	5502
Left Primer	tttcggaaccttcatttctaaaacagct
Right Primer	atacgggtagtacgacattattgaagatgttatgtgaaagg
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20081002_F28C6_1_2_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20081002_F28C6_1_2_L1

return to top of series: 20081002_F28C6_1_2_L1

Download annotations for this experiment

return to top of series: 20081002_F28C6_1_2_L1