20080929_nhr-67_3_L1

headersmall

EPIC home | Show all experiments for nhr-67 | Back to previous page

Details for experimental series: 20080929_nhr-67_3_L1; gene: nhr-67

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20080929_nhr-67_3_L1
Date	9/28/08
Person	JIM
Strain	RW10740
Treatments	None
Gene Assayed	nhr-67
Type of Construct	Promoter Fusion
Imaged Timepoints	245
Edited Timepoints	150
Edited Cells	361
comments	ABpxpxpp, MSxapp, later in ABpraaapp, ABalppppp
Edited By	JIM

return to top of series: 20080929_nhr-67_3_L1

Strain details:

Strain Name	RW10740
Date Created	13 10 2008 12:00:00
Source of Genotype	nhr-67::H1-Wcherry
Reporter Allele	stIs10684
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::nhr-67
Created By	EAP/DKV/JIM

return to top of series: 20080929_nhr-67_3_L1

Construct details:

Plasmid Name	pJIM20::nhr-67
Gene	nhr-67
Transcript	C08F8.8
Promoter Length	5084
Left Primer	tagccttgttgttactatccatgttccg
Right Primer	tgaaaccgcagtcatcattcttggcgcc
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20080929_nhr-67_3_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20080929_nhr-67_3_L1

return to top of series: 20080929_nhr-67_3_L1

Download annotations for this experiment

return to top of series: 20080929_nhr-67_3_L1