20080925_pax-3_3_L1

headersmall

EPIC home | Show all experiments for pax-3 | Back to previous page

Details for experimental series: 20080925_pax-3_3_L1; gene: pax-3

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20080925_pax-3_3_L1
Date	9/25/08
Person	JIM
Strain	RW10742
Treatments	None
Gene Assayed	pax-3
Type of Construct	Promoter Fusion
Imaged Timepoints	271
Edited Timepoints	145
Edited Cells	359
comments	ABpxaapp;ABpxapp; Eprp, ABpxpappp late (~t165)
Edited By	JIM

return to top of series: 20080925_pax-3_3_L1

Strain details:

Strain Name	RW10742
Date Created	13 10 2008 12:00:00
Source of Genotype	pax-3::H1-Wcherry
Reporter Allele	stIs10645
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::pax-3
Created By	EAP/DKV/JIM

return to top of series: 20080925_pax-3_3_L1

Construct details:

Plasmid Name	pJIM20::pax-3
Gene	pax-3
Transcript	F27E5.2
Promoter Length	2616
Left Primer	ttgtcggaagtggttgtactctctcttc
Right Primer	gatagaatctgtggtcattttgttagtagtggatgggatat
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20080925_pax-3_3_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20080925_pax-3_3_L1

return to top of series: 20080925_pax-3_3_L1

Download annotations for this experiment

return to top of series: 20080925_pax-3_3_L1