 |
EPIC home
|
Show all experiments for pax-3
|
Back to previous page
|
Details for experimental series: 20080925_pax-3_3_L1; gene: pax-3 |
experiment details |
strain details |
construct details |
full-size tree |
full-size movie |
download annotations for this experiment |
Experiment details:
Series |
20080925_pax-3_3_L1 |
Date |
9/25/08 |
Person |
JIM |
Strain |
RW10742 |
Treatments |
None |
Gene Assayed |
pax-3 |
Type of Construct |
Promoter Fusion |
Imaged Timepoints |
271 |
Edited Timepoints |
145 |
Edited Cells |
359 |
comments
|
ABpxaapp;ABpxapp; Eprp, ABpxpappp late (~t165) |
Edited By |
JIM |
return to top of series: 20080925_pax-3_3_L1
|
Strain details:
Strain Name |
RW10742 |
Date Created |
13 10 2008 12:00:00 |
Source of Genotype |
pax-3::H1-Wcherry |
Reporter Allele |
stIs10645 |
Lineage Allele |
stIs10024;zuIs178 |
Reporter Construct |
pJIM20::pax-3 |
Created By |
EAP/DKV/JIM |
return to top of series: 20080925_pax-3_3_L1
|
Construct details:
Plasmid Name |
pJIM20::pax-3 |
Gene |
pax-3 |
Transcript |
F27E5.2 |
Promoter Length |
2616 |
Left Primer |
ttgtcggaagtggttgtactctctcttc |
Right Primer |
gatagaatctgtggtcattttgttagtagtggatgggatat |
Vector |
pJIM20 |
Integrated, Expressing Strains |
EXPRESSINGSTRAINS |
return to top of series: 20080925_pax-3_3_L1
|
Full size movie:
return to top of series: 20080925_pax-3_3_L1
|
Fullsize tree:
return to top of series: 20080925_pax-3_3_L1
|
View images
|
Download annotations for this experiment
return to top of series: 20080925_pax-3_3_L1
|