20080925_ZK185_1_3_L1

headersmall

EPIC home | Show all experiments for ZK185.1 | Back to previous page

Details for experimental series: 20080925_ZK185_1_3_L1; gene: ZK185.1

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20080925_ZK185_1_3_L1
Date	9/25/08
Person	JIM
Strain	RW10741
Treatments	None
Gene Assayed	ZK185.1
Type of Construct	Promoter Fusion
Imaged Timepoints	242
Edited Timepoints	135
Edited Cells	364
comments	ubiq/brighter in MSxa
Edited By	JIM

return to top of series: 20080925_ZK185_1_3_L1

Strain details:

Strain Name	RW10741
Date Created	13 10 2008 12:00:00
Source of Genotype	ZK185.1::H1-Wcherry
Reporter Allele	stIs10651
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::ZK185.1
Created By	EAP/DKV/JIM

return to top of series: 20080925_ZK185_1_3_L1

Construct details:

Plasmid Name	pJIM20::ZK185.1
Gene	ZK185.1
Transcript	ZK185.1
Promoter Length	2846
Left Primer	cgcctcattttctcgaaaaatgaaatat
Right Primer	tttgaatttgagatccatttctgaaaaaaaaaaacaattaa
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20080925_ZK185_1_3_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20080925_ZK185_1_3_L1

return to top of series: 20080925_ZK185_1_3_L1

Download annotations for this experiment

return to top of series: 20080925_ZK185_1_3_L1