20080924_F23F12_9_3_L1

headersmall

EPIC home | Show all experiments for F23F12.9 | Back to previous page

Details for experimental series: 20080924_F23F12_9_3_L1; gene: F23F12.9

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20080924_F23F12_9_3_L1
Date	9/24/08
Person	JIM
Strain	RW10710
Treatments	None
Gene Assayed	F23F12.9
Type of Construct	Promoter Fusion
Imaged Timepoints	264
Edited Timepoints	130
Edited Cells	362
comments	biased ubiq
Edited By	JIM

return to top of series: 20080924_F23F12_9_3_L1

Strain details:

Strain Name	RW10710
Date Created	27 09 2008 12:00:00
Source of Genotype	F23F12.9::H1-Wcherry
Reporter Allele	stIs10642
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::F23F12.9
Created By	EAP/DKV/JIM

return to top of series: 20080924_F23F12_9_3_L1

Construct details:

Plasmid Name	pJIM20::F23F12.9
Gene	F23F12.9a
Transcript	F23F12.9a
Promoter Length	3672
Left Primer	attggcagaccatatttttttggaagtc
Right Primer	ttgcatggtgttgctcatattgttggacgttgttagc
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20080924_F23F12_9_3_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20080924_F23F12_9_3_L1

return to top of series: 20080924_F23F12_9_3_L1

Download annotations for this experiment

return to top of series: 20080924_F23F12_9_3_L1