20080923_lin-32_1_L1

headersmall

EPIC home | Show all experiments for lin-32 | Back to previous page

Details for experimental series: 20080923_lin-32_1_L1; gene: lin-32

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20080923_lin-32_1_L1
Date	9/23/08
Person	JIM
Strain	RW10711
Treatments	None
Gene Assayed	lin-32
Type of Construct	Promoter Fusion
Imaged Timepoints	264
Edited Timepoints	150
Edited Cells	379
comments	ABalapa, ABarpapa, ABplaaaaa, ABpxapaa
Edited By	JIM

return to top of series: 20080923_lin-32_1_L1

Strain details:

Strain Name	RW10711
Date Created	27 09 2008 12:00:00
Source of Genotype	lin-32::H1-Wcherry
Reporter Allele	stIs10637
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::lin-32
Created By	EAP/DKV/JIM

return to top of series: 20080923_lin-32_1_L1

Construct details:

Plasmid Name	pJIM20::lin-32
Gene	lin-32
Transcript	T14F9.5
Promoter Length	3730
Left Primer	gtatgaaatgaacaaatcatgcggactt
Right Primer	gtattgctcccagctcatggttgg
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20080923_lin-32_1_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20080923_lin-32_1_L1

return to top of series: 20080923_lin-32_1_L1

Download annotations for this experiment

return to top of series: 20080923_lin-32_1_L1