20080915_dmd-4_9_L1

headersmall

EPIC home | Show all experiments for dmd-4 | Back to previous page

Details for experimental series: 20080915_dmd-4_9_L1; gene: dmd-4

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20080915_dmd-4_9_L1
Date	9/14/08
Person	JIM
Strain	RW10707
Treatments	None
Gene Assayed	dmd-4
Type of Construct	Promoter Fusion
Imaged Timepoints	247
Edited Timepoints	128
Edited Cells	364
comments	MSxapa
Edited By	pete

return to top of series: 20080915_dmd-4_9_L1

Strain details:

Strain Name	RW10707
Date Created	27 09 2008 12:00:00
Source of Genotype	dmd-4::H1-Wcherry
Reporter Allele	stIs10540
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::dmd-4
Created By	EAP/DKV/JIM

return to top of series: 20080915_dmd-4_9_L1

Construct details:

Plasmid Name	pJIM20::dmd-4
Gene	dmd-4
Transcript	C27C12.6
Promoter Length	2446
Left Primer	ttgagctcccatatattcatttgtgtcc
Right Primer	tagattaccgatcatcattatctatagatcagctaataac
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20080915_dmd-4_9_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20080915_dmd-4_9_L1

return to top of series: 20080915_dmd-4_9_L1

Download annotations for this experiment

return to top of series: 20080915_dmd-4_9_L1