20080914_ceh-21_6_L2

headersmall

EPIC home | Show all experiments for ceh-21 | Back to previous page

Details for experimental series: 20080914_ceh-21_6_L2; gene: ceh-21

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20080914_ceh-21_6_L2
Date	9/14/08
Person	JIM
Strain	RW10708
Treatments	None
Gene Assayed	ceh-21
Type of Construct	Promoter Fusion
Imaged Timepoints	255
Edited Timepoints	140
Edited Cells	370
comments	ubiq -> AB spec
Edited By	JIM

return to top of series: 20080914_ceh-21_6_L2

Strain details:

Strain Name	RW10708
Date Created	27 09 2008 12:00:00
Source of Genotype	ceh-21::H1-Wcherry
Reporter Allele	stIs10566
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::ceh-21
Created By	EAP/DKV/JIM

return to top of series: 20080914_ceh-21_6_L2

Construct details:

Plasmid Name	pJIM20::ceh-21
Gene	ceh-21
Transcript	T26C11.6
Promoter Length	2146
Left Primer	aaacaacgcctaggttagtttttttccc
Right Primer	ttgaaattgctgagacatctaaaaaatattatggtaaaaa
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20080914_ceh-21_6_L2

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20080914_ceh-21_6_L2

return to top of series: 20080914_ceh-21_6_L2

Download annotations for this experiment

return to top of series: 20080914_ceh-21_6_L2