20080912_tbx-37_b12_L2

headersmall

EPIC home | Show all experiments for tbx-37 | Back to previous page

Details for experimental series: 20080912_tbx-37_b12_L2; gene: tbx-37

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20080912_tbx-37_b12_L2
Date	9/11/08
Person	JIM
Strain	RW10705
Treatments	None
Gene Assayed	tbx-37
Type of Construct	Promoter Fusion
Imaged Timepoints	269
Edited Timepoints	150
Edited Cells	359
comments	ABa
Edited By	EAP

return to top of series: 20080912_tbx-37_b12_L2

Strain details:

Strain Name	RW10705
Date Created	27 09 2008 12:00:00
Source of Genotype	tbx-37::H1-Wcherry
Reporter Allele	stIs10499
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::tbx-37
Created By	EAP/DKV/JIM

return to top of series: 20080912_tbx-37_b12_L2

Construct details:

Plasmid Name	pJIM20::tbx-37
Gene	tbx-37
Transcript	Y47D3A.12
Promoter Length	2432
Left Primer	aaattcaccgcacacctttaataagtcc
Right Primer	acatacatatgaacgcatgggggc
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20080912_tbx-37_b12_L2

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20080912_tbx-37_b12_L2

return to top of series: 20080912_tbx-37_b12_L2

Download annotations for this experiment

return to top of series: 20080912_tbx-37_b12_L2