20080909_T23G5_6_15_L1

headersmall

EPIC home | Show all experiments for T23G5.6 | Back to previous page

Details for experimental series: 20080909_T23G5_6_15_L1; gene: T23G5.6

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20080909_T23G5_6_15_L1
Date	9/9/08
Person	JIM
Strain	RW10608
Treatments	None
Gene Assayed	T23G5.6
Type of Construct	Promoter Fusion
Imaged Timepoints	249
Edited Timepoints	145
Edited Cells	357
comments	Brightest in ABarp/pla, E and C
Edited By	JIM

return to top of series: 20080909_T23G5_6_15_L1

Strain details:

Strain Name	RW10608
Date Created	10 09 2008 12:00:00
Source of Genotype	T23G5.6::H1-Wcherry
Reporter Allele	stIs10683
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::T23G5.6
Created By	EAP/DKV/JIM

return to top of series: 20080909_T23G5_6_15_L1

Construct details:

Plasmid Name	pJIM20::T23G5.6
Gene	T23G5.6
Transcript	T23G5.6
Promoter Length	4328
Left Primer	actcgtacgtaacttctgatccaacgaa
Right Primer	gagaatcactatcctcatattcattttgttgccattcccat
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20080909_T23G5_6_15_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20080909_T23G5_6_15_L1

return to top of series: 20080909_T23G5_6_15_L1

Download annotations for this experiment

return to top of series: 20080909_T23G5_6_15_L1