20080909_F21D5_9_5_L1

headersmall

EPIC home | Show all experiments for F21D5.9 | Back to previous page

Details for experimental series: 20080909_F21D5_9_5_L1; gene: F21D5.9

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20080909_F21D5_9_5_L1
Date	9/9/08
Person	JIM
Strain	RW10619
Treatments	None
Gene Assayed	F21D5.9
Type of Construct	Promoter Fusion
Imaged Timepoints	269
Edited Timepoints	170
Edited Cells	409
comments	anterior stripes in ABpxpa
Edited By	JIM

return to top of series: 20080909_F21D5_9_5_L1

Strain details:

Strain Name	RW10619
Date Created	10 09 2008 12:00:00
Source of Genotype	F21D5.9::H1-Wcherry
Reporter Allele	stIs10635
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::F21D5.9
Created By	EAP/DKV/JIM

return to top of series: 20080909_F21D5_9_5_L1

Construct details:

Plasmid Name	pJIM20::F21D5.9
Gene	F21D5.9
Transcript	F21D5.9
Promoter Length	3686
Left Primer	aagagctaagtgtgatcggtatgggatt
Right Primer	cattggaccatctgccattcttagttgaaaaaatgacgttg
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20080909_F21D5_9_5_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20080909_F21D5_9_5_L1

return to top of series: 20080909_F21D5_9_5_L1

Download annotations for this experiment

return to top of series: 20080909_F21D5_9_5_L1