 |
EPIC home
|
Show all experiments for dve-1
|
Back to previous page
|
Details for experimental series: 20080905_dve-1_15_L1; gene: dve-1 |
experiment details |
strain details |
construct details |
full-size tree |
full-size movie |
download annotations for this experiment |
Experiment details:
Series |
20080905_dve-1_15_L1 |
Date |
9/5/08 |
Person |
JIM |
Strain |
RW10611 |
Treatments |
None |
Gene Assayed |
dve-1 |
Type of Construct |
Promoter Fusion |
Imaged Timepoints |
251 |
Edited Timepoints |
155 |
Edited Cells |
358 |
comments
|
gut from E4; hyp late? (~t190), 3-fold symmetric trios in pharynx at end of series, 7-25 |
Edited By |
JIM |
return to top of series: 20080905_dve-1_15_L1
|
Strain details:
Strain Name |
RW10611 |
Date Created |
10 09 2008 12:00:00 |
Source of Genotype |
dve-1::H1-Wcherry |
Reporter Allele |
stIs10692 |
Lineage Allele |
stIs10024;zuIs178 |
Reporter Construct |
pJIM20::dve-1 |
Created By |
EAP/DKV/JIM |
return to top of series: 20080905_dve-1_15_L1
|
Construct details:
Plasmid Name |
pJIM20::dve-1 |
Gene |
dve-1a |
Transcript |
ZK1193.5a |
Promoter Length |
5108 |
Left Primer |
tgaatcacaacctccaatcactagtcaa |
Right Primer |
taccctcattgggaacatatctagctgaa |
Vector |
pJIM20 |
Integrated, Expressing Strains |
EXPRESSINGSTRAINS |
return to top of series: 20080905_dve-1_15_L1
|
Full size movie:
return to top of series: 20080905_dve-1_15_L1
|
Fullsize tree:
return to top of series: 20080905_dve-1_15_L1
|
View images
|
Download annotations for this experiment
return to top of series: 20080905_dve-1_15_L1
|