20080829_T23G4_1_1_L1

headersmall

EPIC home | Show all experiments for tlp-1 | Back to previous page

Details for experimental series: 20080829_T23G4_1_1_L1; gene: tlp-1

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20080829_T23G4_1_1_L1
Date	8/29/08
Person	JIM
Strain	RW10609
Treatments	None
Gene Assayed	tlp-1
Type of Construct	Promoter Fusion
Imaged Timepoints	269
Edited Timepoints	140
Edited Cells	366
comments	Cxxp, Posterior gut, AB blast lineages
Edited By	JIM

return to top of series: 20080829_T23G4_1_1_L1

Strain details:

Strain Name	RW10609
Date Created	10 09 2008 12:00:00
Source of Genotype	T23G4.1::H1-Wcherry
Reporter Allele	stIs10681
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::T23G4.1
Created By	EAP/DKV/JIM

return to top of series: 20080829_T23G4_1_1_L1

Construct details:

Plasmid Name	pJIM20::T23G4.1
Gene	T23G4.1
Transcript	T23G4.1
Promoter Length	5106
Left Primer	gaagggatccgaaaaccatttttaaagt
Right Primer	tgaatgtgtggagaccataactggaaatg
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20080829_T23G4_1_1_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20080829_T23G4_1_1_L1

return to top of series: 20080829_T23G4_1_1_L1

Download annotations for this experiment

return to top of series: 20080829_T23G4_1_1_L1