20080819_D1081_8_L2

headersmall

EPIC home | Show all experiments for D1081.8 | Back to previous page

Details for experimental series: 20080819_D1081_8_L2; gene: D1081.8

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20080819_D1081_8_L2
Date	8/20/08
Person	JIM
Strain	RW10595
Treatments	None
Gene Assayed	D1081.8
Type of Construct	Promoter Fusion
Imaged Timepoints	247
Edited Timepoints	140
Edited Cells	367
comments	D, Cmu, AB/MS subsets
Edited By	JIM

return to top of series: 20080819_D1081_8_L2

Strain details:

Strain Name	RW10595
Date Created	25 08 2008 12:00:00
Source of Genotype	D1081.8::H1-Wcherry
Reporter Allele	stIs10669
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::D1081.8
Created By	EAP/DKV/JIM

return to top of series: 20080819_D1081_8_L2

Construct details:

Plasmid Name	pJIM20::D1081.8
Gene	D1081.8
Transcript	D1081.8
Promoter Length	2478
Left Primer	taagggcacattttgatcactgtttttc
Right Primer	gataataactcgcaccatgtttggttttgcttactgcaacg
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20080819_D1081_8_L2

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20080819_D1081_8_L2

return to top of series: 20080819_D1081_8_L2

Download annotations for this experiment

return to top of series: 20080819_D1081_8_L2