20080812_hlh-16_12_L1

headersmall

EPIC home | Show all experiments for hlh-16 | Back to previous page

Details for experimental series: 20080812_hlh-16_12_L1; gene: hlh-16

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20080812_hlh-16_12_L1
Date	8/12/08
Person	JIM
Strain	RW10588
Treatments	None
Gene Assayed	hlh-16
Type of Construct	Promoter Fusion
Imaged Timepoints	250
Edited Timepoints	145
Edited Cells	359
comments	ABpxpaaaa, ABalapp
Edited By	JIM

return to top of series: 20080812_hlh-16_12_L1

Strain details:

Strain Name	RW10588
Date Created	25 08 2008 12:00:00
Source of Genotype	hlh-16::H1-Wcherry
Reporter Allele	stIs10544
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::hlh-16
Created By	EAP/DKV/JIM

return to top of series: 20080812_hlh-16_12_L1

Construct details:

Plasmid Name	pJIM20::hlh-16
Gene	hlh-16
Transcript	DY3.3
Promoter Length	2459
Left Primer	tgtgcagttgagtttgtgttctacgatt
Right Primer	cggtgattccgaagacataatcggaga
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20080812_hlh-16_12_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20080812_hlh-16_12_L1

return to top of series: 20080812_hlh-16_12_L1

Download annotations for this experiment

return to top of series: 20080812_hlh-16_12_L1