20080811_Y106G6H_4_9_L2

headersmall

EPIC home | Show all experiments for Y106G6H.4 | Back to previous page

Details for experimental series: 20080811_Y106G6H_4_9_L2; gene: Y106G6H.4

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20080811_Y106G6H_4_9_L2
Date	8/10/08
Person	JIM
Strain	RW11066
Treatments	None
Gene Assayed	Y106G6H.4
Type of Construct	Promoter Fusion
Imaged Timepoints	254
Edited Timepoints	145
Edited Cells	372
comments	Dim red brightest in ABalpp
Edited By	JIM

return to top of series: 20080811_Y106G6H_4_9_L2

Strain details:

Strain Name	RW11066
Date Created	n/a
Source of Genotype	Y106G6H.4::H1-Wcherry
Reporter Allele	stIs10582
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::Y106G6H.4
Created By	EAP/JIM/DKV

return to top of series: 20080811_Y106G6H_4_9_L2

Construct details:

Plasmid Name	pJIM20::Y106G6H.4
Gene	Y106G6H.4
Transcript	Y106G6H.4
Promoter Length	2113
Left Primer	gaattctcatcgatttttcattctgcag
Right Primer	gtgactccattggtccattgctcg
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20080811_Y106G6H_4_9_L2

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20080811_Y106G6H_4_9_L2

return to top of series: 20080811_Y106G6H_4_9_L2

Download annotations for this experiment

return to top of series: 20080811_Y106G6H_4_9_L2