20080809_nhr-57_9_L2

headersmall

EPIC home | Show all experiments for nhr-57 | Back to previous page

Details for experimental series: 20080809_nhr-57_9_L2; gene: nhr-57

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20080809_nhr-57_9_L2
Date	8/9/08
Person	JIM
Strain	RW10579
Treatments	None
Gene Assayed	nhr-57
Type of Construct	Promoter Fusion
Imaged Timepoints	264
Edited Timepoints	130
Edited Cells	357
comments	E, AB/C subsets
Edited By	pete

return to top of series: 20080809_nhr-57_9_L2

Strain details:

Strain Name	RW10579
Date Created	25 08 2008 12:00:00
Source of Genotype	nhr-57::H1-Wcherry
Reporter Allele	stIs10519
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::nhr-57
Created By	EAP/DKV/JIM

return to top of series: 20080809_nhr-57_9_L2

Construct details:

Plasmid Name	pJIM20::nhr-57
Gene	nhr-57
Transcript	T05B4.2
Promoter Length	2051
Left Primer	caattcatccagcaatgtatttcctcat
Right Primer	ttcgcgagccaccaacatctcttgattcact
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20080809_nhr-57_9_L2

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20080809_nhr-57_9_L2

return to top of series: 20080809_nhr-57_9_L2

Download annotations for this experiment

return to top of series: 20080809_nhr-57_9_L2