20080808_ceh-41_2_L1

headersmall

EPIC home | Show all experiments for ceh-41 | Back to previous page

Details for experimental series: 20080808_ceh-41_2_L1; gene: ceh-41

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20080808_ceh-41_2_L1
Date	8/8/08
Person	JIM
Strain	RW10585
Treatments	None
Gene Assayed	ceh-41
Type of Construct	Promoter Fusion
Imaged Timepoints	255
Edited Timepoints	135
Edited Cells	385
comments	asymmetric in C/D (Dp!) /MS muscle, AB subset
Edited By	JIM

return to top of series: 20080808_ceh-41_2_L1

Strain details:

Strain Name	RW10585
Date Created	25 08 2008 12:00:00
Source of Genotype	ceh-41::H1-Wcherry
Reporter Allele	stIs10543
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::ceh-41
Created By	EAP/DKV/JIM

return to top of series: 20080808_ceh-41_2_L1

Construct details:

Plasmid Name	pJIM20::ceh-41
Gene	ceh-41
Transcript	T26C11.5
Promoter Length	2432
Left Primer	ttcttttcttcctaattggctcgtgaat
Right Primer	aacaaaatgctgggacatctgaaattatgataatgg
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20080808_ceh-41_2_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20080808_ceh-41_2_L1

return to top of series: 20080808_ceh-41_2_L1

Download annotations for this experiment

return to top of series: 20080808_ceh-41_2_L1