20080807_nhr-79_1_L1

headersmall

EPIC home | Show all experiments for nhr-79 | Back to previous page

Details for experimental series: 20080807_nhr-79_1_L1; gene: nhr-79

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20080807_nhr-79_1_L1
Date	8/7/08
Person	JIM
Strain	RW10580
Treatments	None
Gene Assayed	nhr-79
Type of Construct	Promoter Fusion
Imaged Timepoints	249
Edited Timepoints	135
Edited Cells	369
comments	E from E8, Chyp from 350, AB? from 350+ 30'
Edited By	JIM

return to top of series: 20080807_nhr-79_1_L1

Strain details:

Strain Name	RW10580
Date Created	25 08 2008 12:00:00
Source of Genotype	nhr-79::H1-Wcherry
Reporter Allele	stIs10548
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::nhr-79
Created By	EAP/DKV/JIM

return to top of series: 20080807_nhr-79_1_L1

Construct details:

Plasmid Name	pJIM20::nhr-79
Gene	nhr-79
Transcript	T26H2.9
Promoter Length	2304
Left Primer	tctgggagctatgatatgcatttttttg
Right Primer	acacttcccacgcaccatttttatgc
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20080807_nhr-79_1_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20080807_nhr-79_1_L1

return to top of series: 20080807_nhr-79_1_L1

Download annotations for this experiment

return to top of series: 20080807_nhr-79_1_L1