 |
EPIC home
|
Show all experiments for nhr-79
|
Back to previous page
|
Details for experimental series: 20080807_nhr-79_1_L1; gene: nhr-79 |
experiment details |
strain details |
construct details |
full-size tree |
full-size movie |
download annotations for this experiment |
Experiment details:
Series |
20080807_nhr-79_1_L1 |
Date |
8/7/08 |
Person |
JIM |
Strain |
RW10580 |
Treatments |
None |
Gene Assayed |
nhr-79 |
Type of Construct |
Promoter Fusion |
Imaged Timepoints |
249 |
Edited Timepoints |
135 |
Edited Cells |
369 |
comments
|
E from E8, Chyp from 350, AB? from 350+ 30' |
Edited By |
JIM |
return to top of series: 20080807_nhr-79_1_L1
|
Strain details:
Strain Name |
RW10580 |
Date Created |
25 08 2008 12:00:00 |
Source of Genotype |
nhr-79::H1-Wcherry |
Reporter Allele |
stIs10548 |
Lineage Allele |
stIs10024;zuIs178 |
Reporter Construct |
pJIM20::nhr-79 |
Created By |
EAP/DKV/JIM |
return to top of series: 20080807_nhr-79_1_L1
|
Construct details:
Plasmid Name |
pJIM20::nhr-79 |
Gene |
nhr-79 |
Transcript |
T26H2.9 |
Promoter Length |
2304 |
Left Primer |
tctgggagctatgatatgcatttttttg |
Right Primer |
acacttcccacgcaccatttttatgc |
Vector |
pJIM20 |
Integrated, Expressing Strains |
EXPRESSINGSTRAINS |
return to top of series: 20080807_nhr-79_1_L1
|
Full size movie:
return to top of series: 20080807_nhr-79_1_L1
|
Fullsize tree:
return to top of series: 20080807_nhr-79_1_L1
|
View images
|
Download annotations for this experiment
return to top of series: 20080807_nhr-79_1_L1
|