20080807_nhr-68_1_L1

headersmall

EPIC home | Show all experiments for nhr-68 | Back to previous page

Details for experimental series: 20080807_nhr-68_1_L1; gene: nhr-68

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20080807_nhr-68_1_L1
Date	8/7/08
Person	JIM
Strain	RW10581
Treatments	None
Gene Assayed	nhr-68
Type of Construct	Promoter Fusion
Imaged Timepoints	257
Edited Timepoints	140
Edited Cells	355
comments	E, C and AB hyp
Edited By	pete

return to top of series: 20080807_nhr-68_1_L1

Strain details:

Strain Name	RW10581
Date Created	25 08 2008 12:00:00
Source of Genotype	nhr-68::H1-Wcherry
Reporter Allele	stIs10509
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::nhr-68
Created By	EAP/DKV/JIM

return to top of series: 20080807_nhr-68_1_L1

Construct details:

Plasmid Name	pJIM20::nhr-68
Gene	nhr-68
Transcript	H12C20.3
Promoter Length	2352
Left Primer	tcaaaaagcatttgaaacatattggagc
Right Primer	aacctctttgttctccattgacggaggattagaaccg
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20080807_nhr-68_1_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20080807_nhr-68_1_L1

return to top of series: 20080807_nhr-68_1_L1

Download annotations for this experiment

return to top of series: 20080807_nhr-68_1_L1