20080805_sea-1_5_L1

headersmall

EPIC home | Show all experiments for sea-1 | Back to previous page

Details for experimental series: 20080805_sea-1_5_L1; gene: sea-1

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20080805_sea-1_5_L1
Date	8/5/08
Person	JIM
Strain	RW10583
Treatments	None
Gene Assayed	sea-1
Type of Construct	Promoter Fusion
Imaged Timepoints	251
Edited Timepoints	140
Edited Cells	362
comments	ubiq
Edited By	JIM

return to top of series: 20080805_sea-1_5_L1

Strain details:

Strain Name	RW10583
Date Created	25 08 2008 12:00:00
Source of Genotype	sea-1::H1-Wcherry
Reporter Allele	stIs10495
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::sea-1
Created By	EAP/DKV/JIM

return to top of series: 20080805_sea-1_5_L1

Construct details:

Plasmid Name	pJIM20::sea-1
Gene	sea-1
Transcript	F19B10.9
Promoter Length	2231
Left Primer	ccttgatagtttcctcttgctcttcgat
Right Primer	gttgatgatggtgtccattctctgaaaattca
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20080805_sea-1_5_L1

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20080805_sea-1_5_L1

return to top of series: 20080805_sea-1_5_L1

Download annotations for this experiment

return to top of series: 20080805_sea-1_5_L1