 |
EPIC home
|
Show all experiments for lin-26
|
Back to previous page
|
Details for experimental series: 20080805_lin-26_5_L2; gene: lin-26 |
experiment details |
strain details |
construct details |
full-size tree |
full-size movie |
download annotations for this experiment |
Experiment details:
Series |
20080805_lin-26_5_L2 |
Date |
8/5/08 |
Person |
JIM |
Strain |
RW10587 |
Treatments |
None |
Gene Assayed |
lin-26 |
Type of Construct |
Promoter Fusion |
Imaged Timepoints |
244 |
Edited Timepoints |
131 |
Edited Cells |
355 |
comments
|
orignally labeled RW11063; AB hyp/MS,C,D muscle |
Edited By |
pete |
return to top of series: 20080805_lin-26_5_L2
|
Strain details:
Strain Name |
RW10587 |
Date Created |
25 08 2008 12:00:00 |
Source of Genotype |
lin-26::H1-Wcherry |
Reporter Allele |
stIs10536 |
Lineage Allele |
stIs10024;zuIs178 |
Reporter Construct |
pJIM20::lin-26 |
Created By |
EAP/DKV/JIM |
return to top of series: 20080805_lin-26_5_L2
|
Construct details:
Plasmid Name |
pJIM20::lin-26 |
Gene |
lin-26 |
Transcript |
F18A1.2 |
Promoter Length |
2065 |
Left Primer |
ggcaatgtgtctactcgtccatctattc |
Right Primer |
cacaaatttagaaagcatctgaaaataatcaattaaaaatt |
Vector |
pJIM20 |
Integrated, Expressing Strains |
EXPRESSINGSTRAINS |
return to top of series: 20080805_lin-26_5_L2
|
Full size movie:
return to top of series: 20080805_lin-26_5_L2
|
Fullsize tree:
return to top of series: 20080805_lin-26_5_L2
|
View images
|
Download annotations for this experiment
return to top of series: 20080805_lin-26_5_L2
|