20080805_lin-26_5_L2

headersmall

EPIC home | Show all experiments for lin-26 | Back to previous page

Details for experimental series: 20080805_lin-26_5_L2; gene: lin-26

experiment details | strain details | construct details | full-size tree | full-size movie | download annotations for this experiment

Experiment details:

Series	20080805_lin-26_5_L2
Date	8/5/08
Person	JIM
Strain	RW10587
Treatments	None
Gene Assayed	lin-26
Type of Construct	Promoter Fusion
Imaged Timepoints	244
Edited Timepoints	131
Edited Cells	355
comments	orignally labeled RW11063; AB hyp/MS,C,D muscle
Edited By	pete

return to top of series: 20080805_lin-26_5_L2

Strain details:

Strain Name	RW10587
Date Created	25 08 2008 12:00:00
Source of Genotype	lin-26::H1-Wcherry
Reporter Allele	stIs10536
Lineage Allele	stIs10024;zuIs178
Reporter Construct	pJIM20::lin-26
Created By	EAP/DKV/JIM

return to top of series: 20080805_lin-26_5_L2

Construct details:

Plasmid Name	pJIM20::lin-26
Gene	lin-26
Transcript	F18A1.2
Promoter Length	2065
Left Primer	ggcaatgtgtctactcgtccatctattc
Right Primer	cacaaatttagaaagcatctgaaaataatcaattaaaaatt
Vector	pJIM20
Integrated, Expressing Strains	EXPRESSINGSTRAINS

return to top of series: 20080805_lin-26_5_L2

Full size movie:

if quicktime plugin unavailable try clicking here

return to top of series: 20080805_lin-26_5_L2

return to top of series: 20080805_lin-26_5_L2

Download annotations for this experiment

return to top of series: 20080805_lin-26_5_L2