|
EPIC home
|
Show all experiments for pha-4
|
Back to previous page
|
Details for experimental series: 20060818_pha4_b2; gene: pha-4 |
experiment details |
strain details |
construct details |
full-size tree |
full-size movie |
download annotations for this experiment |
Experiment details:
Series |
20060818_pha4_b2 |
Date |
8/19/06 |
Person |
JIM |
Strain |
RW10062 |
Treatments |
None |
Gene Assayed |
pha-4 |
Type of Construct |
Promoter Fusion |
Imaged Timepoints |
371 |
Edited Timepoints |
201 |
Edited Cells |
355 |
comments
|
8-40% red channel |
Edited By |
JIM |
return to top of series: 20060818_pha4_b2
|
Strain details:
Strain Name |
RW10062 |
Date Created |
19 07 2006 12:00:00 |
Source of Genotype |
pha-4::H1-Wcherry |
Reporter Allele |
stIs10050 |
Lineage Allele |
stIs10024;zuIs178 |
Reporter Construct |
pJIM20::pha4_4.1kb |
Created By |
JIM |
return to top of series: 20060818_pha4_b2
|
Construct details:
Plasmid Name |
pJIM20::pha4_4.1kb |
Gene |
pha-4a |
Transcript |
F38A6.1a |
Promoter Length |
4100 |
Left Primer |
ttagcccggggcccaaattttatgaccaaatga |
Right Primer |
tagcctaggtctcaaattagatagtccttcaaaaa |
Vector |
pJIM20 |
Integrated, Expressing Strains |
EXPRESSINGSTRAINS |
return to top of series: 20060818_pha4_b2
|
Full size movie:
return to top of series: 20060818_pha4_b2
|
Fullsize tree:
return to top of series: 20060818_pha4_b2
|
View images
|
Download annotations for this experiment
return to top of series: 20060818_pha4_b2
|